View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8284_low_20 (Length: 226)
Name: NF8284_low_20
Description: NF8284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8284_low_20 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 82 - 226
Target Start/End: Original strand, 32016911 - 32017055
Alignment:
| Q |
82 |
ttgaatgttggagtggggaagcgagaggtaagtagatgctgaaagggttttggttagtttggcacgcaattatttgggtgatatggaaagctagaaatgc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32016911 |
ttgaatgttggagtggggaagcgagaggtaagtagatgcggaaagggttttggttagtttggcacgcaattatttgggtgatatggaaagctagaaatgc |
32017010 |
T |
|
| Q |
182 |
aaagatatttgagaatcattcaaaagatgtggaggagatggtgga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32017011 |
aaagatatttgagaatcattcaaaagatgtggaggagatggtgga |
32017055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 32016854 - 32016906
Alignment:
| Q |
1 |
tctaagaattggaggaaaatcatgggattgactttggagaaaaatcatggatt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32016854 |
tctaagaattggaggaaaatcatgggattgactttggagaaaaatcatggatt |
32016906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University