View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8285_low_10 (Length: 229)
Name: NF8285_low_10
Description: NF8285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8285_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 218
Target Start/End: Original strand, 18715447 - 18715660
Alignment:
| Q |
5 |
aatcaactttcggtgtcatgtagcatatgaaaacatctaagaaatagttaaaaagtcataactatttatttctctaaattaaacccattgaacttctaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18715447 |
aatcaactttcggtgtcatgtagcatatgaaaacatctaagaaatagttaaaaagtcataactatttatttctctaaattaaactcattgaacttctaga |
18715546 |
T |
 |
| Q |
105 |
gttgctaactaaaactgagcagctagagtgaaactttttagagagaagctttctaatgtattcatggtttcatgattaagtttctaattagcaaaaaatt |
204 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18715547 |
gttactaactaaaactgagcagctagagtgaaactttttagagagaagctttctaatgtattcatggtttcatgattaagtttctaattagcaaaaaatt |
18715646 |
T |
 |
| Q |
205 |
aaaatgagaataat |
218 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18715647 |
aaaatgagaataat |
18715660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University