View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8285_low_7 (Length: 270)
Name: NF8285_low_7
Description: NF8285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8285_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 40270232 - 40269980
Alignment:
| Q |
1 |
atatatttgtgtgattattgtttctccttcctattcacttggtgtcttattctctcatcgagtctatgtaactcgcccgtttcctttcattctttttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40270232 |
atatatttgtgtgattattgtttctccttcctattcacttggtgtcttattctctcattgagtctatgtaactcgcccgtttcctttcattctttttctt |
40270133 |
T |
 |
| Q |
101 |
cagattcgtaggttgcagaataggtatttccttatacttgtagatttgccaagagttccttcattttggtttgtctatatattaagtggtgatcattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40270132 |
cagattcgtaggttgcagaataggtatttccttatacttgtagatttgtcaagagttccttcattttggtttgtctatatattaagtggtgatcattatt |
40270033 |
T |
 |
| Q |
201 |
ttgcaactttaagacgatgcaactattttggtatgaagttgtttcagtacttt |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40270032 |
ttgcaactttaagatgatgcaactattttggtatgaagttttttcagtacttt |
40269980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 93 - 167
Target Start/End: Complemental strand, 40262955 - 40262880
Alignment:
| Q |
93 |
tttttcttcagattcgtaggttgcagaataggtatttccttatacttgtagatttg-ccaagagttccttcatttt |
167 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| |||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
40262955 |
tttttcttcagattcactagttgcagaatgagtattcccttctatttgtagatttgtccaagagttccttcatttt |
40262880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University