View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8285_low_9 (Length: 229)
Name: NF8285_low_9
Description: NF8285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8285_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 34822200 - 34822083
Alignment:
| Q |
1 |
aaggataagataaatagtttactatgccatttaaatttattttctttttaataaataacaa-aaaatttaaactcttaacaatgagttgagattctctcc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34822200 |
aaggataagataaatagtttactatgccatttaaatttattttctttttaataaataaaaacaaaatttaaactcttaacaatgagttgaaattctctcc |
34822101 |
T |
 |
| Q |
100 |
atttcctaaaataaatgc |
117 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34822100 |
atttcctaaaataaatgc |
34822083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 84 - 116
Target Start/End: Complemental strand, 18392010 - 18391978
Alignment:
| Q |
84 |
agttgagattctctccatttcctaaaataaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
18392010 |
agttgagattctctccatttcctataataaatg |
18391978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University