View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8286_high_12 (Length: 286)
Name: NF8286_high_12
Description: NF8286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8286_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 2786220 - 2786484
Alignment:
| Q |
1 |
actcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaagagggggtttcgcatcaacaggtggattgacagctccagcattgtagatggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2786220 |
actcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaagagggggtttagcatcaaccggtggattgacagctccagcattgtagatggct |
2786319 |
T |
|
| Q |
101 |
ttgattttgggaagatttcttgggcagatgacagatagagaaatagaaaactgcggaaatgctttagcaacatcttcagcatcataaaactggttacctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786320 |
ttgattttgggaagatttcttgggcagatgacagatagagaaatagaaaactgcggaaatgctttagcaacatcttcagcatcataaaactggttacctg |
2786419 |
T |
|
| Q |
201 |
attccgagtcaatggattcattcttcttgggaacatatattggtctcttcaatggataaggatta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786420 |
attccgagtcaatggattcattcttcttgggaacatatattggtctcttcaatggataaggatta |
2786484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 86 - 145
Target Start/End: Complemental strand, 22517521 - 22517462
Alignment:
| Q |
86 |
gcattgtagatggctttgattttgggaagatttcttgggcagatgacagatagagaaata |
145 |
Q |
| |
|
||||||||||||||||| ||||||||||| | | ||||||||| ||| |||||||||||| |
|
|
| T |
22517521 |
gcattgtagatggctttaattttgggaagttgttttgggcagacgaccgatagagaaata |
22517462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 227
Target Start/End: Complemental strand, 22517356 - 22517280
Alignment:
| Q |
151 |
ctgcggaaatgctttagcaacatcttcagcatcataaaactggtt-acctgattccgagtcaatggattcattcttct |
227 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||||||| || || || ||||||||||||||| |||||| |
|
|
| T |
22517356 |
ctgcggaaacgctttagcaacagcttcagcatcatataactggttcacttggtt-tgagtcaatggattcagtcttct |
22517280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 22518280 - 22518232
Alignment:
| Q |
1 |
actcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaaga |
49 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
22518280 |
actcaaggcactgcgggcttccctaaaaccttctgatattaaaataaga |
22518232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University