View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8286_high_7 (Length: 321)
Name: NF8286_high_7
Description: NF8286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8286_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 5888875 - 5889175
Alignment:
| Q |
1 |
aagctaagggaataaattgttccaaaaccataggtgattaagccattctgaatgtcatttacatggttatatcagagattatatacttaagttgttgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5888875 |
aagctaagggaataaattgttccaaaaccataggtgattaagccattctgaatgtcatttacatggttatatcagagattatatacttaagttgttgtgt |
5888974 |
T |
 |
| Q |
101 |
gaatggttcaggagcagtttatgcatgtttggatgtatggggtagagcttgggatgattctgaaatctctagaagcaataagctgaagttaagctattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5888975 |
gaatggttcaggagcagtttatgcatgtttggatgtatggggtagagcttgggatgattctgaaatctctagaagcaataagctgaagttaagctattct |
5889074 |
T |
 |
| Q |
201 |
tgttttttagcttaatttgtttggtgaagggtttcaaggggatagcagaagtggttttattgttgttaggagcatcaaattgatggtgttgctgttagga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5889075 |
tgttttttagcttaatttgtttggtgaagggtttcaaggggatagcagaagtggttttattgttgttaggagcatcaaattgatggtgttgctgttagga |
5889174 |
T |
 |
| Q |
301 |
g |
301 |
Q |
| |
|
| |
|
|
| T |
5889175 |
g |
5889175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University