View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8286_low_11 (Length: 298)
Name: NF8286_low_11
Description: NF8286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8286_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 91 - 283
Target Start/End: Original strand, 31643186 - 31643378
Alignment:
| Q |
91 |
gtgttagccctccggttcggttagaatataagttaagcatgtcagaggattgtaccatccagaaatcgaactcattattctcttctttattatctggttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643186 |
gtgttagccctccggttcggttagaatataagttaagcatgtcaaaggattgtaccatccgggaatcgaactcattattctcttctttattatctggttc |
31643285 |
T |
 |
| Q |
191 |
ttccttaatttcaaccggatgtgaattttcttgttgaagcgccttctcataaggaccgagttgttcgcccatactactaccaatgtcggtact |
283 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643286 |
ttccttaatttcaaccagatgtgaattttcttgttgaagcgccttctcataatgaccgagttgttcgcccatactactaccaatgtcggtact |
31643378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 31643093 - 31643135
Alignment:
| Q |
1 |
tctggtaagctttcaccatctctaaaagagggacagaggcatg |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31643093 |
tctggtaagctttcaccatctctaaaagaggggcagaggcatg |
31643135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University