View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8286_low_22 (Length: 210)
Name: NF8286_low_22
Description: NF8286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8286_low_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 50 - 210
Target Start/End: Complemental strand, 24566643 - 24566483
Alignment:
| Q |
50 |
cataacgagttaccttctttatcttatggaagtatccatcacgtgaacatatttgatttgacaattgacgggtaacagatatggacaagatacgatttat |
149 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566643 |
cataacaagttaccttctttatcttatggaagtatccatcacgtgaacatatttgatttgacaattgacgggtaacagatatggacaagatacgatttat |
24566544 |
T |
 |
| Q |
150 |
gaaattacgatcacttgaattgatgaaactgaattttatcaagttgtttttctgtgtgttt |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24566543 |
gaaattatgatcacttgaattgatgaaactgaattttatcaagttgttttcctgtgtgttt |
24566483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 45532459 - 45532510
Alignment:
| Q |
159 |
atcacttgaattgatgaaactgaattttatcaagttgtttttctgtgtgttt |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
45532459 |
atcacttgaatttatgaaactgaattttatcaagtttttttcctgtgtgttt |
45532510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University