View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8287_high_4 (Length: 239)
Name: NF8287_high_4
Description: NF8287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8287_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 223
Target Start/End: Complemental strand, 32936974 - 32936760
Alignment:
| Q |
8 |
ctgtgagtctgagctgctgttgttgttgtggttagagagaagtgattgacgcattttttgaaggtttgtaataatcaatgcattttttgaaggcaagagg |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32936974 |
ctgtgagtctgagctgctgctgttgttgtggttagagagaagtgattgacgcattttttgaaggtttgtaataatcaatgcattttttgaaggcaagagg |
32936875 |
T |
|
| Q |
108 |
agaggaaagtgttgtgttggtatgactgtggagtcacaagtacattagttgaaaattgttctttgtttctactttggagnnnnnnnntgttggtagagta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32936874 |
agaggaaagtgttgtgttggtatgactgtggagtcacaagtacattagttgaaaattgttctttgtttctactttggag-aaaaaaatgttggtagagta |
32936776 |
T |
|
| Q |
208 |
atctagttattgatgg |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32936775 |
atctagttattgatgg |
32936760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University