View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8287_high_5 (Length: 206)
Name: NF8287_high_5
Description: NF8287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8287_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 178
Target Start/End: Original strand, 52530914 - 52530942
Alignment:
| Q |
150 |
ggaaataaatgaatgacattacatatgat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52530914 |
ggaaataaatgaatgacattacatatgat |
52530942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University