View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8287_low_2 (Length: 492)
Name: NF8287_low_2
Description: NF8287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8287_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 2e-47; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 18 - 114
Target Start/End: Original strand, 2004798 - 2004894
Alignment:
| Q |
18 |
atatgatcataattatggattccgtctacaaacatactcgcaagcagtaccaaatctttgatgagatagatcaattacaagagaagtttattgacat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2004798 |
atatgatcataattatggattccgtctacaaacatactcgcaagcagtaccaaatctttgatgagatagatcaattacaagagaagtttattgacat |
2004894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 215 - 300
Target Start/End: Original strand, 2004995 - 2005080
Alignment:
| Q |
215 |
ccaactcagcaagccagatcagctgttttaaacgatcatatgtgagtcctggtgagattataaaacatgcgagataggggttcaaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
2004995 |
ccaactcagcaagccagatcagctgttttaaacgatcatatgtcagtcctcgtcagattataaaacatgcgagataggggttcaaa |
2005080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 416 - 484
Target Start/End: Original strand, 2005173 - 2005241
Alignment:
| Q |
416 |
tttctcagatcgtcaccccactcccactccttttctcttcctacgtaaaattttgcaccctttcatatc |
484 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2005173 |
tttctcagatcgccaccccactcccactccttttctcttcctacgtaaaattttgcaccctttcatatc |
2005241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 322 - 365
Target Start/End: Original strand, 2005118 - 2005161
Alignment:
| Q |
322 |
atttacacgattgaaatcttctaaatatagtaacagagtaattc |
365 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2005118 |
attttcacgattgaaatcttctaaatatagtaatagagtaattc |
2005161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University