View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8287_low_3 (Length: 242)
Name: NF8287_low_3
Description: NF8287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8287_low_3 |
 | |
|
| [»] scaffold0166 (5 HSPs) |
| | |
|
Alignment Details
Target: scaffold0166 (Bit Score: 122; Significance: 1e-62; HSPs: 5)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 75 - 224
Target Start/End: Complemental strand, 20619 - 20471
Alignment:
| Q |
75 |
aattaggatgaactagaatgaaacactttagtccttggtattctctagcctgtaattttaactatatgtgaaccagtgtattgtctgaagctacctgtgt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
20619 |
aattaggatgaactagaatgaaacactttc-tacttggtattctctagcctgtaattttaactatatgtgaaccagtgtattgtcttaagctacccgtgt |
20521 |
T |
|
| Q |
175 |
tttcattatctccctagaattgttgaagttgtcttatgccatgatacaat |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20520 |
tttcattctctccctagaattgttgaagttgtcttatgccatgatacaat |
20471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 3 - 77
Target Start/End: Original strand, 33630 - 33702
Alignment:
| Q |
3 |
attggaatacatgtaaggggattgccattcacaagaagaaaaacatatgaactcacatttctttctaaaaccaat |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33630 |
attggaatacatgtaaggggattgccattcacaagaag--aaacatatgaactcacatttctttctaaaaccaat |
33702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 20725 - 20683
Alignment:
| Q |
1 |
caattggaatacatgtaaggggattgccattcacaagaagaaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20725 |
caattggaatacatgtaaggggattgccattcacaagaagaaa |
20683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 33912 - 33958
Alignment:
| Q |
159 |
ctgaagctacctgtgttttcattatctccctagaattgttgaagttg |
205 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
33912 |
ctgaagctaccggtgttttcattctctccctagaattgttgaggttg |
33958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 123
Target Start/End: Original strand, 33746 - 33794
Alignment:
| Q |
75 |
aattaggatgaactagaatgaaacactttagtccttggtattctctagc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
33746 |
aattaggatgaactagaatgaaacactttctccctcggtattctctagc |
33794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 75 - 224
Target Start/End: Complemental strand, 24778236 - 24778088
Alignment:
| Q |
75 |
aattaggatgaactagaatgaaacactttagtccttggtattctctagcctgtaattttaactatatgtgaaccagtgtattgtctgaagctacctgtgt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24778236 |
aattaggatgaactagaatgaaacactttc-tacttggtattctctagcctgtaattttaactatatgtgaaccagtgtattgtcttaagctacccgtgt |
24778138 |
T |
|
| Q |
175 |
tttcattatctccctagaattgttgaagttgtcttatgccatgatacaat |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24778137 |
tttcattctctccctagaattgttgaagttgtcttatgccatgatacaat |
24778088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 3 - 77
Target Start/End: Original strand, 24791247 - 24791319
Alignment:
| Q |
3 |
attggaatacatgtaaggggattgccattcacaagaagaaaaacatatgaactcacatttctttctaaaaccaat |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24791247 |
attggaatacatgtaaggggattgccattcacaagaag--aaacatatgaactcacatttctttctaaaaccaat |
24791319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 24778342 - 24778300
Alignment:
| Q |
1 |
caattggaatacatgtaaggggattgccattcacaagaagaaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24778342 |
caattggaatacatgtaaggggattgccattcacaagaagaaa |
24778300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 159 - 205
Target Start/End: Original strand, 24791529 - 24791575
Alignment:
| Q |
159 |
ctgaagctacctgtgttttcattatctccctagaattgttgaagttg |
205 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
24791529 |
ctgaagctaccggtgttttcattctctccctagaattgttgaggttg |
24791575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 123
Target Start/End: Original strand, 24791363 - 24791411
Alignment:
| Q |
75 |
aattaggatgaactagaatgaaacactttagtccttggtattctctagc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
24791363 |
aattaggatgaactagaatgaaacactttctccctcggtattctctagc |
24791411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University