View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8288_low_10 (Length: 270)
Name: NF8288_low_10
Description: NF8288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8288_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 38564559 - 38564812
Alignment:
| Q |
1 |
taaaccactatcacctcctctgtgttctcatcttaaaattcaatagtggctagctagagtcatatatagcaaaacttaatcttttaaatgattgtgcaaa |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38564559 |
taaaccactatcccctcctctgtgttctcatcttaaaattcaatagtggctagctagagtcatatatagcaaaacttaatcttttaaatgattgtgcaag |
38564658 |
T |
|
| Q |
101 |
gttttattatcatatgatgaatttgaagccgcggtgcatgcatattatgcgttctacgcaagtcaatgataggaggcacgtatagggccac-tcaactta |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
38564659 |
gttttattatcatatgatgagtttgaagccgcggtgcatgcatattatgcgttctacgcaagtcaatgataagaggcacgtatagggccacttcaactta |
38564758 |
T |
|
| Q |
200 |
gaatatcctacccattacctttgaaaaatgttaataggaatagaacaccacaca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38564759 |
gaatatcctacccattacctttgaaaaatgttaataggaatagaacaccacaca |
38564812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University