View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8289_low_13 (Length: 268)
Name: NF8289_low_13
Description: NF8289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8289_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 138 - 246
Target Start/End: Original strand, 35607671 - 35607778
Alignment:
| Q |
138 |
ttgtgctactgttgttataattcatcgtcttctttgtttattttgctaatctgttagaatgccaatctgcttcttattttgataacttcttcatctttct |
237 |
Q |
| |
|
||||||||||| | |||||||| || |||||| |||||||||| | ||||||||||||||| | || ||||||||| | |||||||| |||||||||| |
|
|
| T |
35607671 |
ttgtgctactgctattataattg-tcttcttctgtgtttattttaccaatctgttagaatgctattcagcttcttatatctataacttcctcatctttct |
35607769 |
T |
|
| Q |
238 |
gttattata |
246 |
Q |
| |
|
||||||||| |
|
|
| T |
35607770 |
gttattata |
35607778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 219 - 253
Target Start/End: Original strand, 5663274 - 5663308
Alignment:
| Q |
219 |
ataacttcttcatctttctgttattatactactgt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5663274 |
ataacttcttcatctttctgttattatactactgt |
5663308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University