View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8289_low_17 (Length: 227)

Name: NF8289_low_17
Description: NF8289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8289_low_17
NF8289_low_17
[»] chr8 (1 HSPs)
chr8 (27-217)||(43309339-43309529)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 217
Target Start/End: Complemental strand, 43309529 - 43309339
Alignment:
27 caaggtacttcgaaccaactcattaatctcctccttcgtcaacggttcacccaacacttcttctctagacatcacatacctcgggctagtcccgggcaaa 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43309529 caaggtacttcgaaccaactcattaatctcctccttcgtcaacggttcacccaacacttcttctctagacatcacatacctcgggctagtcccgggcaaa 43309430  T
127 aacggaccgggagactgaaccggtttaacacccttcttatgtggcgggggaagaacaaaagaatcaaactccttgagcttcttctcactcg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
43309429 aacggaccgggagactgaaccggtttaacacccttcttatgtggcgggggaagaacaaaagaatcaaactccttgagcttcttcttactcg 43309339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University