View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8289_low_18 (Length: 224)
Name: NF8289_low_18
Description: NF8289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8289_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 21 - 206
Target Start/End: Complemental strand, 9337052 - 9336867
Alignment:
| Q |
21 |
ttctcggttgcatgtcctacatgcacctcctgattggaggagatgcaagtttctttagcttttctgttgctgccgtgtgtcacggggaacatcgtcctgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9337052 |
ttctcggttgcatgtcctacatgcacctcctgattggaggagatgcaagtttctttagcttttatgttgctgccgtgtgtcacagggaacatcgtcctgt |
9336953 |
T |
|
| Q |
121 |
tatcgtcacgcttaaatctgacttctctctggagccgatgatgttttgttgtggggacgacagttggaccatgatacccaacatgc |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336952 |
tatcgtcacacttaaatctgacttctctctggagccgatgatgttttgttgtggggacgacagttggaccatgatacccaacatgc |
9336867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University