View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8290_low_6 (Length: 357)
Name: NF8290_low_6
Description: NF8290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8290_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 15 - 338
Target Start/End: Original strand, 37417631 - 37417951
Alignment:
| Q |
15 |
ttcgtgttctatatagcggttcgttcttacattgattctttcagtgctgtgggtaaatttggtaatttacgtggatgttgcttacgtggacaatatgtgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37417631 |
ttcgtgttctatatagcggttcgttcttacattgattctttcagtgctgtgggtaaatttggtaatttacgtggatgttgcttacgtggacaatatgtgg |
37417730 |
T |
|
| Q |
115 |
cagattgtagccatttagtgagtgccacgtaggggaagattgtcattggtgttgtgtggcgtagtgttattgggagttagtgtaactgtaggaattgtac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37417731 |
cagattgtagccatttagtgagtgccacgtaggggaagattgtcattggtgttgtgtggcgtagtgttattgggagttagtgtaactgtaggaattgtac |
37417830 |
T |
|
| Q |
215 |
acgtaaatgggactatgagatatttacggaactaccattggactgttatctttgcatttttgggagggaggtcgttgagttgtttaacactatgaagaag |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37417831 |
acgtaaatgggactatgagatatttacggaactgccattggactgttatctttgcatttttgggagggaggtcgttgagttgtttaacactat---gaag |
37417927 |
T |
|
| Q |
315 |
atatatgctaatggttgatttctc |
338 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37417928 |
atatatgctaatggttgatttctc |
37417951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University