View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8292_high_6 (Length: 217)
Name: NF8292_high_6
Description: NF8292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8292_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 167
Target Start/End: Complemental strand, 12690973 - 12690818
Alignment:
| Q |
12 |
gagatgaacgaggtgagttgcctcgggtggaaaatccttgtataatactcttatacaccgagagaaaataaagttgcgataacgacctcaccttcgtcga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690973 |
gagatgaacgaggtgagttgcctcgggtggaaaatccttgtataatactcttatacaccgagagaaaataaagttgcgataacgacctcaccttcgtcga |
12690874 |
T |
 |
| Q |
112 |
ggagttacatgtttgagttcattggtaatgattatatatatgaaagttaagattta |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690873 |
ggagttacatgtttgagttcattggtaatgattatatatatgaaagttaagattta |
12690818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University