View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8292_low_10 (Length: 205)

Name: NF8292_low_10
Description: NF8292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8292_low_10
NF8292_low_10
[»] chr4 (1 HSPs)
chr4 (14-187)||(7096713-7096885)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 7096885 - 7096713
Alignment:
14 agaagaaaaaagtatataagcacaaaatcatatatgtatttcaatgacttgtagatatgtgccaaaatccttcacctcaatnnnnnnnntgtaccaaaat 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||    
7096885 agaaaaaaaaagtatataagcacaaaatcatatatgtatttcaatgacttgtagatatgtgccaaaatccttcacctcaataaaaaat-tgtaccaaaat 7096787  T
114 cttgcatagtctataaatcactttcttctattaaattaaatagtattggaaaaaattcactttatattaatatg 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
7096786 cttgcatagtctataaatcactttcttctattaaattaaatagtattgaaaaaaattcactttatattaatatg 7096713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University