View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8292_low_8 (Length: 219)
Name: NF8292_low_8
Description: NF8292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8292_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 9856936 - 9856718
Alignment:
| Q |
1 |
gtatttaaaaagaagagaaattgatcgatgtgtggataaacggagcaagacttggcaataaagagaagagggatagatagggttagtcgtatataaatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9856936 |
gtatttaaaaagaagagaaattgatcgatgtgtggataaacggagcaagacttggcaataaagagaagagggatagatagggttagtcgtatataaatag |
9856837 |
T |
|
| Q |
101 |
agcaaaacttggcaatcaagaaattgattttttgagaaattaccttttaaagtgataggtacagaataaatctttcttttcagaggtgtacggagtaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9856836 |
agcaaaacttggcaatcaagaaattgattttttgagaaattaccttttaaagtgataggtacaaaataaatcttttttttcagaggtgtacggagtaaat |
9856737 |
T |
|
| Q |
201 |
cttgggaatcaagtatgag |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9856736 |
cttgggaatcaagtatgag |
9856718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University