View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8293_low_16 (Length: 239)
Name: NF8293_low_16
Description: NF8293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8293_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 27098713 - 27098923
Alignment:
| Q |
10 |
agtgagatgaagtaattgaaattcttcacacacactactgagtaagagaggaattagcattaccagtagaaggatcagaagaatttgagaaacaagaatt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098713 |
agtgaaatgaagtaattgaaattcttcacacacactactgagtaagagaggaattagcattaccagtagaaggatcagaagaatttgagaaacaagaatt |
27098812 |
T |
|
| Q |
110 |
cttatgattatgcatccaaaccttaaaaacttgtctactcacaccaacactttcacaaaacctttcaatctcttcatcaagttcttttctctgcaatttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098813 |
cttatgattatgcatccaaaccttaaaaacttgtctactcacaccaacactttcacaaaacctttcaatctcttcatcaagttcttttctctgcaatttc |
27098912 |
T |
|
| Q |
210 |
catcctaactt |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
27098913 |
catcctaactt |
27098923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University