View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8293_low_19 (Length: 234)
Name: NF8293_low_19
Description: NF8293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8293_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 34 - 185
Target Start/End: Original strand, 5834401 - 5834552
Alignment:
| Q |
34 |
tagtatcatagagcgaaaatatgacatagcaaaagaaagnnnnnnnnnagagcagctaaagaaagtcttaataatttttatgttagtattttccctctta |
133 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5834401 |
tagtttcatagagcgaaaatatgacatagcaaaagaaagtttttttt-agagcagttaaagaaagtcttaataattgttatgttagtattttccctctta |
5834499 |
T |
|
| Q |
134 |
ctgggattacc-ggtccgatgaatttcaagtattcaattttcgaatctcgggt |
185 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
5834500 |
ctgggattaccgggtcctttgaatttcaagtattcaatttttgaatctcgggt |
5834552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University