View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8293_low_20 (Length: 231)
Name: NF8293_low_20
Description: NF8293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8293_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 3238937 - 3238744
Alignment:
| Q |
18 |
agtaaattggaatttactcagagcatgaatagcctttgaggaagaaactttctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238937 |
agtaaattggaatttactcagagcatgaatagcctttgaggaagaaactttctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgt |
3238838 |
T |
 |
| Q |
118 |
gaattgctcaatcgtccctggggatttcttctcaattgctttactgtttcagtgatgattctccatctcataaatcttacagcttcaactccaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238837 |
gaattgctcaatcgtccctggggatttcttctcaattgctttactgtttcagtgatgattctccatctcataaatcttacagcttcaactccaa |
3238744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 68 - 141
Target Start/End: Complemental strand, 3243022 - 3242949
Alignment:
| Q |
68 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctgggga |
141 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3243022 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatgggga |
3242949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University