View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8293_low_4 (Length: 675)
Name: NF8293_low_4
Description: NF8293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8293_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 387 - 657
Target Start/End: Complemental strand, 4156809 - 4156539
Alignment:
| Q |
387 |
aacaatttaagttccaccgttaataattattattcnnnnnnnnnnnnnccattccttgactttcacgaaaattttgtttctaaacagataatagaaaact |
486 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4156809 |
aacaatttaagttccaccgttaataattattattcttttttcatttttccattccttgactttcacgaaaattttgtttctaaacagataatagaaaact |
4156710 |
T |
 |
| Q |
487 |
actaaataaaaataactcaaccttaattattgtgttgtgttgcttttgttgttgcttcgtgttcttcttttgtggctggtggtggaatctagggtttgaa |
586 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4156709 |
actaaataaaaataactcaaccttaattattgtgttgtgttgcttttgttgttgcttcgtgttcttcttttgtggctggtggtggaatctagggtttgaa |
4156610 |
T |
 |
| Q |
587 |
gaggggnnnnnnnttcgatcttgatcgatggaagctgaagcagagaataattcccagaagggtgatgatgg |
657 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4156609 |
gaggggaaaaaaattcgatcttgatcgatggaagctgaagcagagaataattcccagaagggtgatgatgg |
4156539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 238 - 269
Target Start/End: Complemental strand, 4156958 - 4156927
Alignment:
| Q |
238 |
gtgttggtggaattatagtagtcaagagaaac |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4156958 |
gtgttggtggaattatagtagtcaagagaaac |
4156927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University