View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_124 (Length: 291)
Name: NF8294A_low_124
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_124 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 3 - 279
Target Start/End: Complemental strand, 164331 - 164055
Alignment:
| Q |
3 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggggattcgttatgttcctacttgtgtgtatttgttcctaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
164331 |
atcactagttataagctttctattatggtttataattagaattctttaactgttatcatggagattcgttatgttcctacttgtatgtatttgttcctaa |
164232 |
T |
|
| Q |
103 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctgatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
164231 |
cattgcagtaactgacagtgctatttatataaagcgttctttcattctaatgcaactcaatagttcatttctaaccctttttatggtatcatgagctttt |
164132 |
T |
|
| Q |
203 |
gcataacaacgaacttgatccatattttttgaacactctccgccatgtctgttgaatctctatccactactgatatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
164131 |
gcataacaacgaacttgatccatattttttgaacactctcagccatgtctgttgaatctctatccactactgatatt |
164055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University