View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_126 (Length: 289)
Name: NF8294A_low_126
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_126 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 158 - 289
Target Start/End: Complemental strand, 45596585 - 45596454
Alignment:
| Q |
158 |
ctcagacatctttgatgaaaagaggtttattagttctcttgctgatgatataaaaatcattaagaaacttcccaaggagctggctaatgcaactaaaatg |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
45596585 |
ctcagacatctttgacgaaaagaggtttattagttctcttgctgatgatataaaaatcattaacaaacttcccaaggagctggctaatgcccctaaaatg |
45596486 |
T |
|
| Q |
258 |
gtgaaacaattcaaaagctggtctggtatgga |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45596485 |
gtgaaacaattcaaaagctggtctggtatgga |
45596454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 7 - 67
Target Start/End: Complemental strand, 45596724 - 45596664
Alignment:
| Q |
7 |
ttgataaaaagtcattttggcaagatagtaggtattttttattttaattctcgaggtttat |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45596724 |
ttgataaaaagtcattttggcaagatagtaggtattttttattttaattctcaaggtttat |
45596664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University