View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_141 (Length: 281)
Name: NF8294A_low_141
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_141 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 8 - 277
Target Start/End: Complemental strand, 22660005 - 22659734
Alignment:
| Q |
8 |
catagaataccatttttctcataaaatttaatgaaaaatacnnnnnnnnnnngtttgtaggcctaatgtgagggctttagtagcctttaccctttgaccg |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
22660005 |
cataaaataccatttttctcataaaatttaatgaaaaatacttttttttt--gtttgtaggcctaatgtgacggctttaatagcctt-accctttgaccg |
22659909 |
T |
|
| Q |
108 |
acaaataacaaacaaaatattctctannnnnnnnnnc-----gacactataaaattagagacaattttgagttgaattctgcattttaatatcaaaatta |
202 |
Q |
| |
|
|||||||||||| ||||||| ||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22659908 |
acaaataacaaaaaaaatatcctctactttttttttcttttcgacactataaaattagagacaattttgagttgaatttcgcattttaatatcaaaatta |
22659809 |
T |
|
| Q |
203 |
acttttctaatttaaatgcttttttggtacaagctaaatgcagaaaagatggaatcaaatttacttgaaaaaatc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22659808 |
acttttctaatttaaatgcttttttggtacaagctaaatgcagaaaagatggaatcaaatttacttgaaaaaatc |
22659734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University