View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_191 (Length: 255)
Name: NF8294A_low_191
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_191 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 38322844 - 38322605
Alignment:
| Q |
1 |
atcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcatcactttcgacaagtcgatatcctttgttttctttcagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322844 |
atcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcattactttcgacaagtcgatatcctttgttttctttcagct |
38322745 |
T |
 |
| Q |
101 |
gcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatttagtatagaaaaatgaacctgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38322744 |
gcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatatagtatagaaaaatgaacctgc |
38322645 |
T |
 |
| Q |
201 |
actttttgccaatcagggttgtactttatggctaacacat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322644 |
actttttgccaatcagggttgtactttatggctaacacat |
38322605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University