View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_217 (Length: 249)
Name: NF8294A_low_217
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_217 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 2727695 - 2727939
Alignment:
| Q |
1 |
tgacagtataaaaaatctttacacgatcggtgcatatacggaattagatccttatagttat--ggaagtttcacgtgctacaattcataccttcctaatc |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727695 |
tgacagtataaaaaatctttacactgtcggtgcatatacggaattaaatccttatagttatatggaagtttcacgtgctacaattcataccttcctaatc |
2727794 |
T |
|
| Q |
99 |
caaatggcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgccaaatttcccaaaagatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727795 |
caaatggcaagttagggccaccaacagaattatttctagatgtcctaaggagtaaagtaccaagcaatatcaaaggaaatgccaaatttcccaaaagatc |
2727894 |
T |
|
| Q |
199 |
aagcaatgcaactccccaatttgtatccataggataaacaccaaa |
243 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2727895 |
aagtattgcaactccccaatttgtatccataggataaacaccaaa |
2727939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University