View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_221 (Length: 249)
Name: NF8294A_low_221
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_221 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 21 - 204
Target Start/End: Complemental strand, 19190619 - 19190436
Alignment:
| Q |
21 |
atcacgaccatccctaccatcccctccaaaacttcgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190619 |
atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg |
19190520 |
T |
|
| Q |
121 |
ccatatccaccaatactcgtacgccctccatcaccatatccacccccagaacgcccatatccactctcataacgcacattagcg |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19190519 |
ccatatccaccaatactcgaacgccctccatcaccatatccaccaccagaacgcccatatccactctcataacggtcattagcg |
19190436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University