View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_230 (Length: 247)
Name: NF8294A_low_230
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_230 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 8293841 - 8293621
Alignment:
| Q |
19 |
caacagaaacgtgtacattgcagaaactgataatcaatttaatcgtaacgagagaaaacaatactaacctaactattaacatactaatattctacatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293841 |
caacagaaacgtgtacattgcagaaactgataatcaatttaatcgtcacgagagaaaacaatactaacctaactattaacatactaatattctacatttg |
8293742 |
T |
 |
| Q |
119 |
ttattnnnnnnntagcacctaaaccagagatgcaattaattatatggagatcaaatgcacatgacacggacgctatacaaaacgcagcaacaaaatatct |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293741 |
ttattaaaaaaatagcacctaaaccagagatgcaattaattatatggagatcaaatgcacatgacacggacgctatacaaaacgcagcaacaaaatatct |
8293642 |
T |
 |
| Q |
219 |
ggaatcagagaaattaacacg |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8293641 |
ggaatcagagaaattaacacg |
8293621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University