View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_235 (Length: 246)
Name: NF8294A_low_235
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_235 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 41946135 - 41945920
Alignment:
| Q |
13 |
aatatgattgaaaacttgttcttctttatttgatttgtgaacataaatcatttcatgtcattagttaagacgtgataatatattgaaatatttagtttta |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41946135 |
aatatgattgaaaacttgtttttctttatttgatttgtgaacataaatcatttcatgtcgttagttaagacgtgataatatattgaaatatttagtttta |
41946036 |
T |
 |
| Q |
113 |
aaaagtgttaatgtaatgttttgtggatctnnnnnnntattcttagagagatcctgatgtt-gggaaagagcacaattttctatagttatggcaaatggc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41946035 |
aaaagtgttaatgtaatgttttgtggatctaaaaaaatattcttagagagatcctgatgttggggaaagagcacaattttctatagttatggcaaatggc |
41945936 |
T |
 |
| Q |
212 |
tcttaatgaagctttt |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41945935 |
tcttaatgaagctttt |
41945920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University