View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_239 (Length: 245)
Name: NF8294A_low_239
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_239 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 7 - 195
Target Start/End: Original strand, 4116701 - 4116889
Alignment:
| Q |
7 |
ctgatatgaataattttggttccaacttatgacagacgcacgatatactcgtgatatgtgtctctcatctcttatggtacactttacaacattgaatctc |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
4116701 |
ctgatttgaataattttggttccaacttatcacagacgcacgatatactcgtgatatgtgcatcttatctcttatggtacactttacaacattgaatttc |
4116800 |
T |
|
| Q |
107 |
aagtgtactaaatattacctttcaatagagctgttgagctctttgtttccatcaactacgtcatttagcatgcatattattattaatta |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4116801 |
aagtgtactaaatatgacctttcaatagagttgttgagctctttgtttccatcaactacgtcatttagcatgcgtattattattaatta |
4116889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 245
Target Start/End: Original strand, 4119233 - 4119273
Alignment:
| Q |
205 |
gtataatgtttttgggtaatgtttgttcttgtggcaatgga |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4119233 |
gtataatgtttttgggtaatgtatgttcttgtggcaatgga |
4119273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University