View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_244 (Length: 245)
Name: NF8294A_low_244
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_244 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 29 - 230
Target Start/End: Complemental strand, 753324 - 753123
Alignment:
| Q |
29 |
atcatcaagctatcgtgcatcatagttccataagaatattagttaataattttggagaaagatgccatatatctgagaatcaaacaaaatttaccttcat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
753324 |
atcatcaagctatcgtgcatcatagttccataagaatattagttaataattttggagaaagatgccatatatctgagaatcaaacaaaatttaccttcat |
753225 |
T |
|
| Q |
129 |
gcgagataaataagaaactatgctagggaaattttgattaatatcctgcattgactgcagtggatcagaagcacggactattctctgtacagttggatgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
753224 |
gcgagataaataagaaactatgctagggaaattttgattaatatcctgcattgactgcagaggatcagaagcacggactattctctgtacagtttgatgt |
753125 |
T |
|
| Q |
229 |
cc |
230 |
Q |
| |
|
|| |
|
|
| T |
753124 |
cc |
753123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University