View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_266 (Length: 240)
Name: NF8294A_low_266
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_266 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 32350644 - 32350886
Alignment:
| Q |
11 |
gatgaactggttcaatgatacgggttgggtttgttttggtctatggatttttgttgcagattttgcaattcgtgataattcttgtcgcacagattcaaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350644 |
gatgaactggttcaatgatacgggttgggtttgttttggtctatggatttttgttgcagattttgcaattcgtgataattcttgtcgcacagattcaaag |
32350743 |
T |
|
| Q |
111 |
gattttgccatgaaaataaacaaaagaca-------------agatgaaactggtttgttgttatctaagacagatattatcaaacatgtaggatgcaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32350744 |
gattttgccatgaaaataaacaaaagacaagatgaaatgagtagatgaaactggtttgttgttatctaagacagatattatcaaacatgtaggatgcaac |
32350843 |
T |
|
| Q |
198 |
tagatatattttgttacaattcgatgtgtctttcgcaagaaca |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
32350844 |
tagatatattttgttacaattcgaggtgtatttcgcaagaaca |
32350886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University