View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_267 (Length: 240)
Name: NF8294A_low_267
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_267 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 19437952 - 19438173
Alignment:
| Q |
19 |
caaagacctcaaatatcttcagtttttctgttaccaaaaagagtttcatgttcaactagttatggattgttgaagtctagaacacttcaacatgagtcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19437952 |
caaagacctcaaatatcttcagtttttctgttaccaaaaagagtttcaagttcaactagttatggattgttgaagtctagaacacttcaacatgagtcta |
19438051 |
T |
 |
| Q |
119 |
taaattcaagcttggtgttctctccattggtgaagaaggcctttggagtaaatcaaagaaggtttcctgttgttgcagccttagcagcagatgctgatga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
19438052 |
taaattcaagcttggtgttctctccattggtgaagaaggcctttggagtaaatcaaagaaggtttccagttgttacagccttagcagcagatgctgatga |
19438151 |
T |
 |
| Q |
219 |
tagtgaaattgaaatctctaat |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19438152 |
tagtgaaattgaaatctctaat |
19438173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University