View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_280 (Length: 237)
Name: NF8294A_low_280
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_280 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 27 - 220
Target Start/End: Complemental strand, 38145410 - 38145217
Alignment:
| Q |
27 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggttttgg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38145410 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggtttcgg |
38145311 |
T |
|
| Q |
127 |
tgtagatggtgccaaacaccttaggttcattgctaaggaatcaaggatggttgcgaatggaggttcatttggagtgtaaattgttgtatgaaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38145310 |
tgtagatggtgccaaacaccttaggttcattgctaaggaatcaaggatggttgcgaatgaaggttcatttggagtgtaaattgttgtatgaaat |
38145217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 27 - 150
Target Start/End: Original strand, 11787410 - 11787533
Alignment:
| Q |
27 |
cacttcttactcttagatggattccaagtttcttggagcaaattacggctgcttggacatgggaatcttgggagggtgtgaatatgaattcgggttttgg |
126 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| || ||| | || ||| |||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
11787410 |
cacttcttactcttagatgaataccaagtttctttgaacaagtaacagctacttggacatgtgaatcggttaagggtgtgaatatgaattcgggttttgg |
11787509 |
T |
|
| Q |
127 |
tgtagatggtgccaaacaccttag |
150 |
Q |
| |
|
| ||| ||| ||||| ||||||| |
|
|
| T |
11787510 |
agcagaaggtaccaaataccttag |
11787533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University