View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_301 (Length: 231)
Name: NF8294A_low_301
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_301 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 25014515 - 25014292
Alignment:
| Q |
1 |
agccttcactctacttgtcaagatctgctagcattgtgatgtttgctgcatattttgcgtacttgatctttcaactatggacacacaggcaattattcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25014515 |
agccttcactctacttgtcaagatctgctagcattgtgatgttggctgcatattttgcttacttgatctttcaactatggacacacaggcaattatttga |
25014416 |
T |
|
| Q |
101 |
agctgaagatgtatgttttcttaattaaaccatatatgaaaatgatggatcattgatttgcaattttaatttttattataagtgtttataacatgattca |
200 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25014415 |
agctgaagatgtatgctttcgtaattaaaccatatatgaaaatgatgaatcattgatttgcaattttaatttttattataagtgtttataacatgattca |
25014316 |
T |
|
| Q |
201 |
ttgatgaacaggaaggtgaaggtg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25014315 |
ttgatgaacaggaaggtgaaggtg |
25014292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 119
Target Start/End: Original strand, 5130259 - 5130351
Alignment:
| Q |
27 |
gctagcattgtgatgtttgctgcatattttgcgtacttgatctttcaactatggacacacaggcaattattcgaagctgaagatgtatgtttt |
119 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||| | |||| ||||||||||| ||| | |||||||| ||||| |||||||||||||| |
|
|
| T |
5130259 |
gctagcattgtgatggtgattgcatattttgcataccttttcttccaactatggactcaccgacaattatttgaagcacaagatgtatgtttt |
5130351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University