View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_343 (Length: 227)
Name: NF8294A_low_343
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_343 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 47015009 - 47015191
Alignment:
| Q |
20 |
cattatatgagattgaatcaccaacacatgtgatgaggtcagtttgatgattgaactatcaaatacaggaagaagatcttgatggcgatgagtttgttct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47015009 |
cattatatgagattgaatcaccaacacatgtgatgaggtcagttggatgattgaactatcaaatacaggaagaagatcttgatggcggtgagtttgttcc |
47015108 |
T |
|
| Q |
120 |
gctatcagaattcaactggcttgtgatgggaggcgcaatatgtgtctcatatttcagaagcaatgttttatattattggacat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
47015109 |
gctatcagaattcaactggcttgtgatgggaggcgcaatatgtgtctcatatttcagaagcaatgttttatttttttggacat |
47015191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University