View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_351 (Length: 224)
Name: NF8294A_low_351
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_351 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 24301260 - 24301051
Alignment:
| Q |
13 |
tgttggaagtgttggagtggactctgatcaatgttgaagaaaagtttcctcgttgagttgaaaaaagctcatcaatagctctaaacagatgctcatccga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| || | ||||||||| ||| |||| |||||| ||| |||| | |
|
|
| T |
24301260 |
tgttggaagtgttggagtggactctgatcaatgttgaagaaaagtttctccgttaagcgtatgaaagctcataaatggctccaaacaggtgcgcatcata |
24301161 |
T |
|
| Q |
113 |
acccacactgcgggcttcgaagcccaaatgaaaattggtacaagaatgagcataaagttaaagatattttactaggttgtagggttggaaataaaatatg |
212 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24301160 |
acccacactgcgggcttcaaagcccaagtgaaaattggtacaagaatgagcataaagttaaagatattttactaggttgtatggttggaaataaaatatg |
24301061 |
T |
|
| Q |
213 |
atatgtctaa |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
24301060 |
atatgtctaa |
24301051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University