View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_358 (Length: 221)
Name: NF8294A_low_358
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_358 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 216
Target Start/End: Original strand, 22443401 - 22443590
Alignment:
| Q |
24 |
gcaaaagtgtcttcggaagaacttaaaataaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtacttgc |
123 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443401 |
gcaaaagtgtcttcggaa---cttaaaaaaaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtacttgc |
22443497 |
T |
 |
| Q |
124 |
aaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatattcttcgaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22443498 |
aaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatatggttcgaca |
22443590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University