View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8294A_low_366 (Length: 219)

Name: NF8294A_low_366
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8294A_low_366
NF8294A_low_366
[»] chr1 (11 HSPs)
chr1 (17-207)||(25700997-25701190)
chr1 (87-139)||(16216427-16216478)
chr1 (96-207)||(9109284-9109396)
chr1 (96-200)||(25652276-25652380)
chr1 (90-170)||(38746617-38746696)
chr1 (99-192)||(12318404-12318497)
chr1 (99-139)||(13547023-13547064)
chr1 (99-139)||(13548934-13548975)
chr1 (96-153)||(41136010-41136066)
chr1 (99-183)||(10157818-10157901)
chr1 (96-139)||(29136438-29136482)
[»] chr3 (6 HSPs)
chr3 (96-192)||(5270563-5270659)
chr3 (96-195)||(50432522-50432619)
chr3 (96-177)||(1683664-1683746)
chr3 (96-191)||(20937848-20937943)
chr3 (96-174)||(49199364-49199442)
chr3 (115-192)||(35138583-35138659)
[»] chr5 (5 HSPs)
chr5 (96-193)||(8038390-8038486)
chr5 (98-186)||(316956-317044)
chr5 (99-174)||(10054714-10054789)
chr5 (99-178)||(33905919-33905998)
chr5 (102-171)||(4160796-4160864)
[»] chr8 (8 HSPs)
chr8 (96-192)||(11137217-11137313)
chr8 (96-192)||(3772382-3772477)
chr8 (99-174)||(7624846-7624919)
chr8 (100-207)||(10240318-10240425)
chr8 (99-139)||(40221938-40221979)
chr8 (96-135)||(2999740-2999780)
chr8 (97-200)||(9633488-9633590)
chr8 (99-174)||(11384178-11384253)
[»] chr7 (9 HSPs)
chr7 (96-192)||(5116797-5116893)
chr7 (95-192)||(43363349-43363447)
chr7 (87-160)||(14301374-14301446)
chr7 (99-174)||(8452099-8452173)
chr7 (95-161)||(22552498-22552563)
chr7 (96-139)||(22328323-22328367)
chr7 (96-193)||(8359197-8359293)
chr7 (96-192)||(1360054-1360150)
chr7 (96-192)||(29608927-29609023)
[»] chr4 (13 HSPs)
chr4 (115-191)||(41961609-41961684)
chr4 (99-174)||(6199766-6199842)
chr4 (96-174)||(3786153-3786231)
chr4 (110-200)||(6719761-6719850)
chr4 (99-192)||(12073586-12073678)
chr4 (97-135)||(40974970-40975008)
chr4 (97-192)||(33990037-33990131)
chr4 (96-174)||(12119735-12119813)
chr4 (96-154)||(33090071-33090129)
chr4 (99-139)||(27416899-27416940)
chr4 (96-171)||(32091632-32091706)
chr4 (99-174)||(26699341-26699416)
chr4 (99-174)||(55085341-55085416)
[»] chr2 (8 HSPs)
chr2 (83-174)||(16676407-16676498)
chr2 (96-173)||(30217945-30218022)
chr2 (99-190)||(42261368-42261457)
chr2 (96-200)||(28197084-28197186)
chr2 (101-141)||(36282852-36282892)
chr2 (101-139)||(7451314-7451353)
chr2 (97-174)||(34811121-34811197)
chr2 (99-139)||(45727122-45727161)
[»] scaffold0002 (1 HSPs)
scaffold0002 (99-190)||(490203-490292)
[»] chr6 (1 HSPs)
chr6 (132-190)||(11660831-11660888)
[»] scaffold0197 (1 HSPs)
scaffold0197 (99-174)||(1295-1370)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 25701190 - 25700997
Alignment:
Q  17 aaaagtgttagtagagttttatttgggctggtcaaattatgtcgaactaga---aaaatccttgcagtggttattttatatactctactctctttatctt 113  Q
    |||||||||| |||||||||||||||||||||||||||||| |||||| ||   ||||||||||| ||| ||||||| ||||||||||||||||||||||    
T  25701190 aaaagtgttactagagttttatttgggctggtcaaattatgccgaactggatgaaaaatccttgctgtgtttattttctatactctactctctttatctt 25701091  T
Q  114 gttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactattttagatatt 207  Q
    |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25701090 gttattttttggttcggttgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactattttagatatt 25700997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 87 - 139
Target Start/End: Complemental strand, 16216478 - 16216427
Alignment:
Q  87 ttttatatactctactctctttatcttgttattctttggttcgattgtggttt 139  Q
    ||||||||||||||| |||||||||| |||||||||| |||||||||||||||    
T  16216478 ttttatatactctac-ctctttatctcgttattctttagttcgattgtggttt 16216427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 96 - 207
Target Start/End: Complemental strand, 9109396 - 9109284
Alignment:
Q  96 ctctactctctttatcttg--ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 193  Q
    ||||||||||||||||||   ||||||||||||| ||||||||||  ||||| | | ||||||||||| || ||||||||||| | ||| || ||||||     
T  9109396 ctctactctctttatctttgtttattctttggtttgattgtggtta-tgcttcacagttggttgctagcttagatctagatctgttgttattacttgtgg 9109298  T
Q  194 ctattttagatatt 207  Q
     |||||||| ||||    
T  9109297 ttattttagttatt 9109284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 96 - 200
Target Start/End: Original strand, 25652276 - 25652380
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgac 194  Q
    ||||||||||||||| ||||| ||| ||||||| |  |||||||| ||||||| |||| ||||||||||| |||||| || | | |||||| |||||||     
T  25652276 ctctactctctttattttgtttattatttggtttgcctgtggttt-tgctttacacttagttgctagattagatctaaatttgttgttgttacttgtgat 25652374  T
Q  195 tatttt 200  Q
    ||||||    
T  25652375 tatttt 25652380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 170
Target Start/End: Complemental strand, 38746696 - 38746617
Alignment:
Q  90 tatatactctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatct 170  Q
    |||||||| |||||||||||||||||| ||||||| ||| |||||| |||| |||||| | ||| ||||||| || |||||    
T  38746696 tatatactatactctctttatcttgttgttctttgattcaattgtgatttg-gctttacagttgattgctagtttagatct 38746617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 192
Target Start/End: Complemental strand, 12318497 - 12318404
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||| |||||||||||| |||||||||||| ||| || ||| ||||||| | ||||||||||| ||  |||||||||| | |||||||| ||||    
T  12318497 tactccctttatcttgtttattctttggttcaattatgattt-tgctttacaattggttgctaggttaaatctagatctgttgttgttgcgtgtg 12318404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 139
Target Start/End: Complemental strand, 13547064 - 13547023
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggttt 139  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
T  13547064 tactctctttatcttgtttattctttggttggattgtggttt 13547023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 139
Target Start/End: Complemental strand, 13548975 - 13548934
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggttt 139  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
T  13548975 tactctctttatcttgtttattctttggttggattgtggttt 13548934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 153
Target Start/End: Original strand, 41136010 - 41136066
Alignment:
Q  96 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttg 153  Q
    ||||||||||||||||||||||||||||| |||  ||||| ||| ||||||| |||||    
T  41136010 ctctactctctttatcttgttattctttgattcagttgtgattt-tgctttacacttg 41136066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 183
Target Start/End: Original strand, 10157818 - 10157901
Alignment:
Q  99 tactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttg 183  Q
    ||||||||||||| |||| ||||||| |||||||||| | | | ||||| ||||| || ||| ||| ||||||||||||| ||||    
T  10157818 tactctctttatcctgttgttctttgattcgattgtgatat-tactttacacttgatttctaaatttgatctagatctattgttg 10157901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 139
Target Start/End: Original strand, 29136438 - 29136482
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggttt 139  Q
    ||||||||||||||||||| |||| |||||||| |||||||||||    
T  29136438 ctctactctctttatcttgtttatcctttggttagattgtggttt 29136482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 5270563 - 5270659
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    |||||||||||||||| |||| ||||||||||||||||||||||| ||| ||| |||||||||||||||| ||||||||||||| |||||||||||||    
T  5270563 ctctactctctttatcatgtttattctttggttcgattgtggttt-tgcattacacttggttgctagattagatctagatctattgttgttgcttgtg 5270659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 96 - 195
Target Start/End: Complemental strand, 50432619 - 50432522
Alignment:
Q  96 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 195  Q
    ||||||||||||||||||||| | |||||||| ||||||||||| ||||||  |||| ||||||||||| |||||||||||||  |||||||||||||||    
T  50432619 ctctactctctttatcttgttgt-ctttggtttgattgtggttt-tgctttccacttcgttgctagattggatctagatctattattgttgcttgtgact 50432522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 177
Target Start/End: Original strand, 1683664 - 1683746
Alignment:
Q  96 ctctactctctttatcttgtt--attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatcta 177  Q
    |||||||||||||||||||||   || ||||||||||||||||||| |  |||| ||| |||| ||||||| ||||||||||||    
T  1683664 ctctactctctttatcttgtttatttttttggttcgattgtggttt-tattttacactaggtttctagattagatctagatcta 1683746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 191
Target Start/End: Original strand, 20937848 - 20937943
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgt 191  Q
    ||||||||||||||||||| ||||| ||||||||||||||| ||| | ||||| ||||| ||  |||||| ||||||||| | | |||| |||||||    
T  20937848 ctctactctctttatcttgtttattatttggttcgattgtgattt-tactttacacttgattaatagattagatctagatttgttgttgctgcttgt 20937943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 174
Target Start/End: Complemental strand, 49199442 - 49199364
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    ||||||||||||||||||| |||| |||||||| ||||||||||| |||| |  ||||| || ||||||| |||||||||    
T  49199442 ctctactctctttatcttgtttatcctttggttagattgtggttt-tgctatgcacttgttttctagattagatctagat 49199364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 115 - 192
Target Start/End: Complemental strand, 35138659 - 35138583
Alignment:
Q  115 ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||||||||||||||||||||||| || |||| || |  |||||||||| |||||| || | | |||||||||||||    
T  35138659 ttattctttggttcgattgtggttt-tgttttacacctaattgctagattggatctaaatatgttgttgttgcttgtg 35138583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 58; Significance: 1e-24; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 96 - 193
Target Start/End: Original strand, 8038390 - 8038486
Alignment:
Q  96 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 193  Q
    |||||||||||||||||| ||||| ||||||||||||||||||| | ||||| |||||||||||||||| |||| |||||||| ||||||| ||||||    
T  8038390 ctctactctctttatcttattattttttggttcgattgtggttt-ttctttacacttggttgctagattagatcaagatctattgttgttgattgtga 8038486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 98 - 186
Target Start/End: Original strand, 316956 - 317044
Alignment:
Q  98 ctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttg 186  Q
    ||||||||||||| ||||| |||||||||||| |||||||||| ||||||| |||||||||||||||  ||||||||||| |||||||||    
T  316956 ctactctctttattttgtttattctttggttcaattgtggttt-tgctttacacttggttgctagataagatctagatctgtcgttgttg 317044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 10054789 - 10054714
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||| ||||||||||| ||| |||| |||||||||  ||| ||||||| |||||||||||||||| |||||||||    
T  10054789 tactctttttatcttgtttattttttgcttcgattgtaattt-tgctttacacttggttgctagattagatctagat 10054714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 178
Target Start/End: Complemental strand, 33905998 - 33905919
Alignment:
Q  99 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctat 178  Q
    |||||||||||||||| |||||| ||||||||| |||||||| | ||||| ||||| ||||||||||  |||| |||||||    
T  33905998 tactctctttatcttgtttattcattggttcgaatgtggttt-tactttacacttgattgctagattaaatcttgatctat 33905919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 171
Target Start/End: Original strand, 4160796 - 4160864
Alignment:
Q  102 tctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatcta 171  Q
    |||| |||||||||| |||||||||||||||| |||||| ||||||| ||||||||| |||||| ||||||    
T  4160796 tctcattatcttgtttattctttggttcgattatggttt-tgctttacacttggttg-tagattagatcta 4160864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 11137217 - 11137313
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||||||||||||||||||| |||| |||||||||||||||||| | ||||||||||| |||||||||| ||| ||||| | |  ||||||||||||    
T  11137217 ctctactctctttatcttgtttattcattggttcgattgtggttttt-ctttatacttgattgctagattagatttagatatgttattgttgcttgtg 11137313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 3772382 - 3772477
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||| |||| |  ||||| || |||||||  |||||||| | | |||||||||||||    
T  3772382 ctctactctctttatcttgtttattctttggttagattgtggttt-tgctatgcacttgatttctagattaaatctagat-tgttgttgttgcttgtg 3772477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 7624919 - 7624846
Alignment:
Q  99 tactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||||||| |||| || |||||||||||||||||||||| | ||||| || |||||||||| || |||||||||    
T  7624919 tactctctttgtcttattgttctttggttcgattgtggttt-tactttacacatggttgctag-ttagatctagat 7624846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 207
Target Start/End: Original strand, 10240318 - 10240425
Alignment:
Q  100 actctctttatcttgtta--ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactat 197  Q
    |||||||||||||||||   || ||||||||||||||||||| ||||||| | || ||| ||||||| ||||||||| | | ||| ||| ||||| ||||    
T  10240318 actctctttatcttgtttatttttttggttcgattgtggttt-tgctttacatttcgtttctagattagatctagat-tgttgttattgtttgtggctat 10240415  T
Q  198 tttagatatt 207  Q
    ||||| ||||    
T  10240416 tttagttatt 10240425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 139
Target Start/End: Original strand, 40221938 - 40221979
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggttt 139  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
T  40221938 tactctctttatcttgttcattctttggttggattgtggttt 40221979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 135
Target Start/End: Complemental strand, 2999780 - 2999740
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtg 135  Q
    ||||||||||||||||||| ||||||||||||| |||||||    
T  2999780 ctctactctctttatcttgtttattctttggttagattgtg 2999740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 200
Target Start/End: Complemental strand, 9633590 - 9633488
Alignment:
Q  97 tctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 195  Q
    |||||||||||||||||| |||||||||||||| |||||| ||| |  |||| | ||| ||| || ||| ||||||||| | || ||||||||||||| |    
T  9633590 tctactctctttatcttgtttattctttggttcaattgtgattt-tattttacaattgattgttatattagatctagatttgtc-ttgttgcttgtgatt 9633493  T
Q  196 atttt 200  Q
    |||||    
T  9633492 atttt 9633488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 11384178 - 11384253
Alignment:
Q  99 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||||||||||||| |||| |||||||| ||||||||||| |||| |  ||||| || ||||||| |||||||||    
T  11384178 tactctctttatcttgtttatcctttggttagattgtggttt-tgctatgcacttgttttctagattagatctagat 11384253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 9)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 5116797 - 5116893
Alignment:
Q  96 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattc-gatctagatctatcgttgttgcttgtg 192  Q
    |||||| ||||||||||||||||| | |||||||||||||| || ||||||| |||||||| | |||||| ||||||||| ||| |||||||||||||    
T  5116797 ctctaccctctttatcttgttattatatggttcgattgtggatt-tgctttacacttggttacgagattcagatctagatatattgttgttgcttgtg 5116893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 95 - 192
Target Start/End: Complemental strand, 43363447 - 43363349
Alignment:
Q  95 actctactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||  |  | |||| |||||| ||||||||| | |  ||||||||||||    
T  43363447 actctactctctttatcttgtttgttctttggttcgattgtggtttgtgctttgcaaatagttgttagattagatctagatttgttattgttgcttgtg 43363349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 87 - 160
Target Start/End: Complemental strand, 14301446 - 14301374
Alignment:
Q  87 ttttatatactctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgcta 160  Q
    |||| ||||||||||||||||||||||||||||||||| || ||||||| ||| ||||| | |||| |||||||    
T  14301446 ttttctatactctactctctttatcttgttattctttgatttgattgtgattt-tgcttgacacttagttgcta 14301374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 8452173 - 8452099
Alignment:
Q  99 tactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||| |||||||||| ||||||||||||||||||||||| ||||||| | ||| ||  |||||| |||||||||    
T  8452173 tactctttttatcttgtcattctttggttcgattgtggttt-tgctttacatttgatttttagattagatctagat 8452099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 95 - 161
Target Start/End: Complemental strand, 22552563 - 22552498
Alignment:
Q  95 actctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctag 161  Q
    |||||||||||||||||||||| ||||||||| |||| | ||||| | ||||| |||||||||||||    
T  22552563 actctactctctttatcttgttgttctttggtacgatcgaggttt-ttctttacacttggttgctag 22552498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 139
Target Start/End: Complemental strand, 22328367 - 22328323
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggttt 139  Q
    ||||||||||||||||||||| ||||||| |||||||||||||||    
T  22328367 ctctactctctttatcttgtttattcttttgttcgattgtggttt 22328323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 193
Target Start/End: Complemental strand, 8359293 - 8359197
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtga 193  Q
    |||||||||| |||||||||| || |||||||| ||||||||||| |||| |  ||||| || ||||||| ||||||||| | | ||||||||||||||    
T  8359293 ctctactctcattatcttgtttatcctttggttagattgtggttt-tgctatgcacttgttttctagattagatctagat-tgttgttgttgcttgtga 8359197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 192
Target Start/End: Complemental strand, 1360150 - 1360054
Alignment:
Q  96 ctctactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||| |||||||||||||||  |||||| ||||||||||||||| ||||||| |||| |||  |||||| |||||| |  | | |||||||||||||    
T  1360150 ctctattctctttatcttgtttcttcttttgttcgattgtggttt-tgctttacacttagtttttagattagatctaaaattgttgttgttgcttgtg 1360054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 192
Target Start/End: Original strand, 29608927 - 29609023
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    ||||||||||||||||||| |||| ||||| || ||||||||||| || | |  |||||||| ||| ||| ||||||||| | | |||||||||||||    
T  29608927 ctctactctctttatcttgtttatcctttgcttagattgtggtttttgatatgcacttggtttctatattagatctagat-tgttgttgttgcttgtg 29609023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 13)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 115 - 191
Target Start/End: Original strand, 41961609 - 41961684
Alignment:
Q  115 ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgt 191  Q
    ||||||||||||| ||||||||||| ||||||| || ||||| ||||||| ||||||||||||| ||||||||||||    
T  41961609 ttattctttggtttgattgtggttt-tgctttaaacctggttactagattagatctagatctattgttgttgcttgt 41961684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 6199842 - 6199766
Alignment:
Q  99 tactctctttatcttgtta-ttctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||  | || |||| |||||| |||||||||    
T  6199842 tactctctttatcttgtttgttctttggttcgattgtggtttgtgctttgcaattagttgttagattagatctagat 6199766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 3786153 - 3786231
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    ||||||||||||||||||||| ||||||||||||||||||  ||| || |||| |||||||||||| ||| |||||||||    
T  3786153 ctctactctctttatcttgttcattctttggttcgattgtaattt-tgttttacacttggttgctatattagatctagat 3786231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 110 - 200
Target Start/End: Original strand, 6719761 - 6719850
Alignment:
Q  110 tcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgactatttt 200  Q
    ||||||| ||||||||||  |||||||||| ||||||  |||||||| ||||||| ||||||||||| | ||| |||| ||||||| ||||    
T  6719761 tcttgttgttctttggttttattgtggttt-tgctttgcacttggtttctagattagatctagatctgttgtttttgcctgtgactgtttt 6719850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 99 - 192
Target Start/End: Original strand, 12073586 - 12073678
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    |||||||||||||||||| ||||||||||| ||||||||||| || | |  |||||||| ||||||| ||||||||| | | |||||||||||||    
T  12073586 tactctctttatcttgtttattctttggttagattgtggttt-tgttatgcacttggtttctagattagatctagat-tgttgttgttgcttgtg 12073678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 97 - 135
Target Start/End: Complemental strand, 40975008 - 40974970
Alignment:
Q  97 tctactctctttatcttgttattctttggttcgattgtg 135  Q
    |||||||||||||||||||| ||||||||||||||||||    
T  40975008 tctactctctttatcttgttgttctttggttcgattgtg 40974970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 192
Target Start/End: Original strand, 33990037 - 33990131
Alignment:
Q  97 tctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtg 192  Q
    |||||||||||||||||| |||||||||||||| ||| ||| || |||| |  |||||||| ||||||| ||||||||| | | |||||||||||||    
T  33990037 tctactctctttatcttgtttattctttggttcaattctggatt-tgctatgcacttggtttctagattagatctagat-tgttgttgttgcttgtg 33990131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 174
Target Start/End: Original strand, 12119735 - 12119813
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    ||||||||||||||||||| ||| |||||||| |||||||||||| |||| |  |||| ||| ||||||| |||||||||    
T  12119735 ctctactctctttatcttgtttagtctttggtccgattgtggttt-tgctatgcacttagtttctagattagatctagat 12119813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 154
Target Start/End: Original strand, 33090071 - 33090129
Alignment:
Q  96 ctctactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttgg 154  Q
    |||| |||||||||||||||| ||| ||||||||||||||||||| ||||||| ||||||    
T  33090071 ctctgctctctttatcttgtttattttttggttcgattgtggttt-tgctttacacttgg 33090129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 99 - 139
Target Start/End: Complemental strand, 27416940 - 27416899
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggttt 139  Q
    |||||||||||||||||| ||||||||||| |||||||||||    
T  27416940 tactctctttatcttgtttattctttggttggattgtggttt 27416899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 96 - 171
Target Start/End: Original strand, 32091632 - 32091706
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatcta 171  Q
    |||||| |||||||||||| ||||||||| |||| |||||||||  | ||||| ||||| |||||||||| ||||||    
T  32091632 ctctacgctctttatcttgtttattctttagttcaattgtggtt--ttctttacacttgtttgctagattagatcta 32091706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 26699416 - 26699341
Alignment:
Q  99 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||||||||||||| |||||||||||||| ||| |||||| |||| |  |||||| | ||||||| |||||||||    
T  26699416 tactctctttatcttgtttattctttggttcaattatggttt-tgctatgcacttggattctagattagatctagat 26699341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 55085416 - 55085341
Alignment:
Q  99 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||||||||||||| |||||| |||||| ||||||||||| |||| |  |||||||| ||| ||| |||||||||    
T  55085416 tactctctttatcttgtttattccttggttggattgtggttt-tgctatgcacttggtttctaaattagatctagat 55085341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 83 - 174
Target Start/End: Original strand, 16676407 - 16676498
Alignment:
Q  83 gttattttatatactctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||| ||||||||||||| ||||||||| | || |||||||||||||||||||||| || |||| |||| ||||||||||| |||||||||    
T  16676407 gttattctatatactctactttctttatctagtttgttctttggttcgattgtggttt-tgatttacactttgttgctagattagatctagat 16676498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 96 - 173
Target Start/End: Complemental strand, 30218022 - 30217945
Alignment:
Q  96 ctctactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctaga 173  Q
    ||||||||||||||||||| ||||||||||||| |||||||| ||||| |||| |||||||| ||||||| ||||||||    
T  30218022 ctctactctctttatcttgtttattctttggtttgattgtgg-ttgtgttttacacttggtttctagattggatctaga 30217945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 190
Target Start/End: Complemental strand, 42261457 - 42261368
Alignment:
Q  99 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttg 190  Q
    |||||||||||||||| |||||  |||||| | ||||||||| |||| || |||||||||||||||| ||||||||| ||| |||||||||||    
T  42261457 tactctctttatcttgattatt--ttggtttgtttgtggttt-tgctatacacttggttgctagattagatctagatatattgttgttgcttg 42261368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 200
Target Start/End: Original strand, 28197084 - 28197186
Alignment:
Q  96 ctctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttgtgact 195  Q
    |||||||||||| ||| |||| ||||||| ||| ||||| | || ||||||| |||||||||||||||   |||||||| |  |||||||||||||||||    
T  28197084 ctctactctctt-atcatgttgttctttgattcaattgttggtt-tgctttacacttggttgctagataaaatctagatatgccgttgttgcttgtgact 28197181  T
Q  196 atttt 200  Q
    |||||    
T  28197182 atttt 28197186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 141
Target Start/End: Complemental strand, 36282892 - 36282852
Alignment:
Q  101 ctctctttatcttgttattctttggttcgattgtggtttgt 141  Q
    |||||||||||||||||||||||| |||||||||| |||||    
T  36282892 ctctctttatcttgttattctttgattcgattgtgctttgt 36282852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 101 - 139
Target Start/End: Original strand, 7451314 - 7451353
Alignment:
Q  101 ctctctttatcttgtt-attctttggttcgattgtggttt 139  Q
    |||||||||||||||| |||||||||||||||||||||||    
T  7451314 ctctctttatcttgtttattctttggttcgattgtggttt 7451353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 97 - 174
Target Start/End: Complemental strand, 34811197 - 34811121
Alignment:
Q  97 tctactctctttatcttgttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    |||||||||||||||||||| ||||||  |||| |||| |||| | ||||| | || ||||||||||| |||||||||    
T  34811197 tctactctctttatcttgttgttcttttattcggttgtagttt-tactttacaattagttgctagattagatctagat 34811121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 139
Target Start/End: Original strand, 45727122 - 45727161
Alignment:
Q  99 tactctctttatcttgttattctttggttcgattgtggttt 139  Q
    ||||||||||||||| ||||||||||||| |||||||||||    
T  45727122 tactctctttatctt-ttattctttggttggattgtggttt 45727161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 190
Target Start/End: Complemental strand, 490292 - 490203
Alignment:
Q  99 tactctctttatcttg-ttattctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttg 190  Q
    |||||||||||||||| |||||  |||||| | ||||||||| |||| || |||||||||||||||| ||||||||| ||| |||||||||||    
T  490292 tactctctttatcttgattatt--ttggtttgtttgtggttt-tgctatacacttggttgctagattagatctagatatattgttgttgcttg 490203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 11660831 - 11660888
Alignment:
Q  132 tgtggtttgtgctttatacttggttgctagattcgatctagatctatcgttgttgcttg 190  Q
    |||||||| ||||||| |||||||||||||||| ||||||||||| | |||||||||||    
T  11660831 tgtggttt-tgctttacacttggttgctagattagatctagatctgttgttgttgcttg 11660888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 174
Target Start/End: Complemental strand, 1370 - 1295
Alignment:
Q  99 tactctctttatcttgtt-attctttggttcgattgtggtttgtgctttatacttggttgctagattcgatctagat 174  Q
    ||||||||||||||| || ||| ||||||| ||||||||||| | ||||| |||||||| ||||||| |||||||||    
T  1370 tactctctttatcttatttattttttggtttgattgtggttt-tactttacacttggtttctagattagatctagat 1295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University