View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_378 (Length: 216)
Name: NF8294A_low_378
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_378 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 22 - 216
Target Start/End: Complemental strand, 42602132 - 42601938
Alignment:
| Q |
22 |
agggcgttgaggtttcttgatgtttgttctctttagtggaataagctagtgttgttgtgaagaatgaagaaaggatacaaaggtttatagaagtgttggg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42602132 |
agggcgttgaggtttcttgatgtttgttctctttagtggtataagctagtgttgttgtgaagaatgaagaaaggatacaaaggtttatagaagtgttggg |
42602033 |
T |
 |
| Q |
122 |
agtggccacgggggaaatcataagatattgtagattaggatatgcacaagtcagcaacatcttattggtggagaattagaatgtggattcccaag |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42602032 |
agtggccacggtggaaatcataagatattgtagattaggatatgcacaagtcagcaacatcttattggtggtgaattagtatgtggattcccaag |
42601938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University