View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_383 (Length: 213)
Name: NF8294A_low_383
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_383 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 33026210 - 33026416
Alignment:
| Q |
1 |
ttgtttggtatgacaaactttctgattcttcgtgttcaccgacttttccaaggaaggaaaaaagtaccaatcttgttgcaaagttgatgggattagaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026210 |
ttgtttggtatgacaaactttctgattcttcgtgttcaccgacttttccaaggaaggaaaaaagtaccaatcttgttgcaaagttgatgggattagaaca |
33026309 |
T |
|
| Q |
101 |
atccccttcaagaacatttccatctgtcatgcaaaaacagtttgagaatcaaaagattgtgaatcagaagagacctgtgttcgagattgacacaccgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33026310 |
atccccttcaagaacatttccatctgtcatgcaaaaacagtctgagaatcaaaagattgtgaatcagaagagacctgtgttcgagattgacacaccgaag |
33026409 |
T |
|
| Q |
201 |
gtaagaa |
207 |
Q |
| |
|
|||||| |
|
|
| T |
33026410 |
ttaagaa |
33026416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University