View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_385 (Length: 212)
Name: NF8294A_low_385
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_385 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 32103493 - 32103698
Alignment:
| Q |
1 |
gaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataggtccactgaacagattgcaccgcagcctgcaacatgtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103493 |
gaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcaccgcagcctgcaacatgtttt |
32103592 |
T |
 |
| Q |
101 |
gaagcttactgcctaatggagatggagccgccattctttattcattcagtcattaccaaacagttttttctttcatttctctgcaatatttaatcatatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103593 |
gaagcttactgcctaatggagatggagcagccattctttattcattcagtcattaccaaacagttttttctttcatttctctgcaatatttaatcatatc |
32103692 |
T |
 |
| Q |
201 |
taaaac |
206 |
Q |
| |
|
|||||| |
|
|
| T |
32103693 |
taaaac |
32103698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University