View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_396 (Length: 208)
Name: NF8294A_low_396
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_396 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 9897822 - 9897997
Alignment:
| Q |
14 |
tggacatcattatgaatcatgaccgaacaaggtttagcttcccctgcaccttggtttggatctaagacaatgtagatatttaccagcacgactaaattac |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
9897822 |
tggacatcattatgaagcatgaccgaacaaggtttagcttcccctgccccttggtttggatctaagacaatgtagatatttaccagcacgactccattgc |
9897921 |
T |
|
| Q |
114 |
actggggtggctagccctgatgacaagtcaattgtttgtattacatccctattatagcctagccatttttgaatat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9897922 |
actggggtggctagccctgatgacaagtcaattgtttgtattacatccctattatagcctagccatttttgaatat |
9897997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University