View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_399 (Length: 206)
Name: NF8294A_low_399
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_399 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 11023283 - 11023186
Alignment:
| Q |
20 |
atggtggccaacggctttttcttcttcgattgttttatcgaagagttgagcattggaaggtgttgttatgatagttacatgttggttttttgatgcta |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
11023283 |
atggtggccggcggctttttcttcttcgattgttttatcgaagagttgagcatttgaaggtgttgttatgatggttacatgttggtttttggatgcta |
11023186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 110 - 189
Target Start/End: Original strand, 11024327 - 11024406
Alignment:
| Q |
110 |
tgatgctaagaagacagtggtgagagctgaaaggatagagaaagctgtgaagaaattgatggatagtaatggggaaggtg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11024327 |
tgatgctaagaagacagtggtgagagctgaaaggatagagaaagctgtgaagaaattgatggatagtaatggtgaaggtg |
11024406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University