View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_400 (Length: 206)
Name: NF8294A_low_400
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_400 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 22 - 106
Target Start/End: Complemental strand, 798444 - 798356
Alignment:
| Q |
22 |
gaaccagagagaacatgtatatatttgtctctattttgtaaattttgctaggcaagcctaagtc----atctagcgagccaaacttaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
798444 |
gaaccagagagaacatgtatatatttgtctctattttgtaaattttgctaggcaagcctaagtcatcgatctagcgagccaaacttaac |
798356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University