View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8294A_low_408 (Length: 203)
Name: NF8294A_low_408
Description: NF8294A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8294A_low_408 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 99 - 202
Target Start/End: Complemental strand, 18787085 - 18786982
Alignment:
| Q |
99 |
gtttaatagcatacaatacaatatcttcttgtttgttgttctcaacacactcgtggcaaagacttatgatccctccaatgccgtcactgctaaaaaatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18787085 |
gtttaatagcatacaatacaatatcttcatgtttgttgttctcaacacactcgtggcaaagacttatgatccctccaatgccgtcgctgctaaaaaatat |
18786986 |
T |
 |
| Q |
199 |
gaga |
202 |
Q |
| |
|
|||| |
|
|
| T |
18786985 |
gaga |
18786982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 37
Target Start/End: Complemental strand, 18787179 - 18787149
Alignment:
| Q |
7 |
aacaggatgctcgtatttgacacagctgcag |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18787179 |
aacaggatgctcgtatttgacacagctgcag |
18787149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University