View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8296_low_6 (Length: 384)
Name: NF8296_low_6
Description: NF8296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8296_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 18 - 171
Target Start/End: Original strand, 5372923 - 5373074
Alignment:
| Q |
18 |
agatggggtataggggaggaccttatgacttgtctcttctcacatagcatgaagacctcatttttcgaactgcggtagatattgacggagtacttgaaag |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
5372923 |
agatggggtataggggaggaccgtatgacttgtctc--ctcacatagcatgaagacctcatttttcgaactgtggtagatattgatggagtacttgaaag |
5373020 |
T |
|
| Q |
118 |
gtgatcctatgtttaccggtaagtaacttggaggatgtgtgacacttatgtagg |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5373021 |
gtgatcctatgtttaccggtaagtaacttggagaatgtgtgacacttatgtagg |
5373074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University